fem tertegun kumemandangmu dm c saat kau tinggalkanku menangis f em murungnya kumengharapmu a dm em f g jelas sudah takkan pedulikan cintaku [ bridge ] f em mestinya tlah kusadari dm e a g c ChordUkulele Hingga Ku Takkan Bisa. LAST CHILD - Duka (Lyrics) Hingga Ku Takkan Bisa Tuk Terbang Tinggi Lagichords F#mBDAkau takkan bisa buatku menjauh. ChordTablature, lyric, sheet, guitar, ukulele song: Takkan Bisa - ADA Band - ( Intro: F C Dm C A# A#m [F]Semakin ku t[C]enggelam [Dm]ke) Chords Songs 2 years ago 314 Empati (2011) ADA Band Slank- Ku tak bisa Intro: C C Em Pernah berpikir 'tuk pergi F C G7 Dan terlintas tinggalkan kau sendiri C Em Sempat ingin sudahi sampai di sini F C G Coba lari dari kenyataan tapi Ref A C#m D E Bm B F# G Em F#m Dm] Chords for Ku Tak Bisa Karaoke with song key, BPM, capo transposer, play along with guitar, piano, ukulele & mandolin. TakBisa Memiliki CHORDS by Via Vallen for GUITAR, UKULELE, and PIANO !! CHORDS USED (Am, F, G, Dm, Em, C, E, A) ~ Released 2017 Intro Am F G Dm Am Em F Am F G Am Verse 1 Am F ku hanya bisa memandangmu G Am tanpa bisa memiliki Am F karena dirimu kekasih temanku G Am dan tak sendiri lagi Dm C mengapa kau masih jatuh G Em cinta padaku Dm C pasti Tak Bisa Memiliki CHORDS by Via Vallen 5UcJ. album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNNNNNNNNNNNNEmNNNNNNNFNNNNNNNNNNNGNNNCNNNNNNNEmNNNNNNNFNNNNNNNCNNNNNNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNCNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNCNNNNNNNNNNNNNNNEmNNNNNNNFNNNNNNCNNNGNNNCNNNNNNNNNEmNNNNNFNNNNNNNCNNNGNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNAmNNNNNNNEmNNNNNNNAmNNNNNNNEmNNNNNNNANNNNNNNGmNNNNNNNBmNNNNNNNAmNNNNNNNEmNNNNNNNAmNNNNNNNEmNNNNNNNFNNNNNNNFmNNNNNNNNNNNNNNNNNNNDmNNNNNNNNFNNNNNNNCNNNNNNNGNNNNCNNDmNNNNNNNFNNNNNNNNCNNNNNNNGNNNNNNNNNNNFNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNDmNNNNNNNFNNNNNNNCNNNNNNGNNNDNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNNNNNNNNNDmNNNNNNNNNFNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login 11 Chords used in the song C, Em, F, G, Dm, Am, Bb, Gm, Bdim, Fm, Bm ← View these chords for the BaritoneTranspose chords Chord diagrams Pin chords to top while scrolling Tablature / Chords Full SongFont size A- A A+ No comment yet Need help, a tip to share, or simply want to talk about this song? Start the discussion! Songs you might like A Thousand Years[ Christina Perri ] 11 Januari[ Gigi ] Can't Take My Eyes Off Of You[ Frankie Valli ] Seberapa Pantas[ Sheila On 7 ] Love Story[ Taylor Swift ] A Whole New World[ Disney ] Shallow[ Lady GAGA ] Karena Kamu Cuma Satu[ Naif ] Fly Me To The Moon[ Frank Sinatra ] Perfect [ Ed Sheeran ] Top Tabs & Chords by Slank, don't miss these songs! Ku Tak BisaAbout this song Ku Tak BisaNo information about this song. Did you cover Ku Tak Bisa on your Ukulele? Share your work! Submit a cover album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNEmNNNNNNNNFNNNNNNNNNNNNGNNNCNNNNNNNNEmNNNNNNNFNNNNNNNNNCNNNNNNNDmNNNNNNNFNNNNNNNNCNNNNNNNNNNGNNNNNDmNNNNNNNFNNNNNNNNCNNNNNNNNGNNNNNNNCNNNNNNNNNNNNNNNNEmNNNNNNNNFNNNNNNNCNNNNGNNNCNNNNNNNEmNNNNNNNNFNNNNNNNCNNNNGNNNNNDmNNNNNFNNNNNNNNCNNNNNNNNGNNNNNNNDmNNNNNNNFNNNNNNNNCNNNNNNNNGNNNNNNNAmNNNNNNNNEmNNNNNNNAmNNNNNNNNEmNNNNNNNNANNNNNNNGmNNNNNNNBmNNNNNNDmNANNNNNNNENNNNNNNNANNNNNNNENNNNNNNNFNNNNNNNNFmNNNNNNNNNNNNNNNNNNNNDmNNNNNNNNNFNNNNNNNCNNNNNNNNGNNNNNNNNNDmNNNNNNFNNNNNNNNCNNNNNNNNGNNNNNNNNNNNNNCNDmNNNNNNNNNFNNNNNNNCNNNNNNNNGNNNNNNNNDmNNNNNNNFNNNNNNNCNNNNNNNNNANNNNNNDmNNNNNNNFNNNNNNNNCNNNNNNNGNNNNNNNNNNNNNNDmNNNNNNNNNNNNFNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose AAACAAAAAAAAAAAAAAAAEmAAAAAAFAAAAAAACAAAAGAACAAAAAAAEmAAAAAAAFAAAAAAACAAAGmAAADADmAAAAAFAAAAAAACAAAAAAAGAAAAAAADmAAAAAAAAFAAAAAACAAAAAAAAGAAAAAACAAAAAAAAAAAAAAAAEmAAAAAAFAAAAAAACAAAGAAACAAAAAAAAEmAAAAAAFAAAAAACAAAGAAAADmAAAAAAAFAAAAAACAAAAAAAAGAAAAAAADmAAAAAAAFAAAAAACAAAAAAAGAAAAAAAAAmAAAAAAAEmAAAAAAAAmAAAAAAEmAAAAAAAAAAAAAAAGmAAAAAAAABAAAADmAAmAAAAAAAEmAAAAAAAAmAAAAAAAEmAAAAAAAFAAAAAAAFmAAAAAAAAAAFAAAAAAAACAAAADmAAAAAAAAAFAAAAAAAACAAAAAAGmAGAAACDmAAAAAAAAAFAAAAAAAACAAAAAAAGAAAAAAAAAAACADADmAAAAAAFAAAAAAACAAAAAAGAAAAAAAADmAAAAAAAFAAAAAAACAAAAAAGAABmAAGADmAAAAAAAFAAAAAAACAAAAAAGAAAAAAAAAAAAAADmAAAAAAAAFAAAAAACAAAAAAAAAAAAAAAAAAN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login

chord ku tak bisa ukulele